mathscience9730 mathscience9730
  • 04-02-2022
  • Social Studies
contestada

The spatial and temporal coordination of vision and the hands or feet that enables people to perform eye-hand and eye-foot coordination skills is known as _____.

Respuesta :

palazzolorachel palazzolorachel
  • 04-02-2022
Perception- Action Coupling

I hope this helps (:
Answer Link

Otras preguntas

What is the additive inverse of -4a
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
in what area of Europe were the majority of warsaw pact countries
How much money, in dollars, does one mole of nickels represent?
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
Why did the American public mostly oppose joining the League of Nations after WWI?