lamber346 lamber346

04-05-2018
Mathematics

contestada

what is the largest possible product of two odd integers whose sum is 42?

Respuesta :

MrGumby MrGumby

04-05-2018

441.

You can tell this because the largest area of any rectangle is when it is a square. Even sides will always produce the greatest area. Thus, 21 and 21 would be the best numbers to use.

Answer Link

Otras preguntas

Adrien needs to use an effective sanitizer to finish cleaning a piece of equipment; he should use a_____ A.sanitizer at a temp of 60F B.sanitizer that has more

During translation, the mrna is read in groups of three bases. true false

Which of these describes an endothermic process? When lithium is placed in water, the temperature of the container increases. The combustion of kerosene re

Jay belsky believes that a major source of family stress is that society does not

Abraham lincoln's and andrew johnson's reconstruction plans shared an emphasis on

NEED HELP FAST!!! The difference of the values of the third quartile and the median of the data set represented by the box plot is (Pictured Below)

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

if 2^x-4=4a^x-6 what is the value of a

What plane contains points C, D, and G? Question 12 options: The plane on the bottom of the figure The plane on the top of the figure The plane on the front sid

what was a power given by the articles of confederation